ID: 909744362

View in Genome Browser
Species Human (GRCh38)
Location 1:79075071-79075093
Sequence AAGCTAGGAAGCAGAATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909744360_909744362 -4 Left 909744360 1:79075052-79075074 CCACGTCTTAACTTGAAAGAAGC No data
Right 909744362 1:79075071-79075093 AAGCTAGGAAGCAGAATTGTAGG No data
909744359_909744362 21 Left 909744359 1:79075027-79075049 CCTTAATGTAAACTATTTTATTA No data
Right 909744362 1:79075071-79075093 AAGCTAGGAAGCAGAATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909744362 Original CRISPR AAGCTAGGAAGCAGAATTGT AGG Intergenic
No off target data available for this crispr