ID: 909751971

View in Genome Browser
Species Human (GRCh38)
Location 1:79172616-79172638
Sequence GGTGCCAAAGGAACAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909751971_909751975 -8 Left 909751971 1:79172616-79172638 CCTGCTTTTGTTCCTTTGGCACC No data
Right 909751975 1:79172631-79172653 TTGGCACCTGGGAATTTTCATGG No data
909751971_909751977 10 Left 909751971 1:79172616-79172638 CCTGCTTTTGTTCCTTTGGCACC No data
Right 909751977 1:79172649-79172671 CATGGTCTGCTATATTGAATAGG No data
909751971_909751978 11 Left 909751971 1:79172616-79172638 CCTGCTTTTGTTCCTTTGGCACC No data
Right 909751978 1:79172650-79172672 ATGGTCTGCTATATTGAATAGGG No data
909751971_909751979 30 Left 909751971 1:79172616-79172638 CCTGCTTTTGTTCCTTTGGCACC No data
Right 909751979 1:79172669-79172691 AGGGCTCTAATTTTGTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909751971 Original CRISPR GGTGCCAAAGGAACAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr