ID: 909752889

View in Genome Browser
Species Human (GRCh38)
Location 1:79185791-79185813
Sequence GTCTTAAAGGGGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909752889_909752901 7 Left 909752889 1:79185791-79185813 CCCTCCTCTTTCCCCTTTAAGAC No data
Right 909752901 1:79185821-79185843 GGGGACATCTTTCTACTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909752889 Original CRISPR GTCTTAAAGGGGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr