ID: 909754860

View in Genome Browser
Species Human (GRCh38)
Location 1:79212554-79212576
Sequence AATGGTGAAGGAAGTAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909754860_909754863 17 Left 909754860 1:79212554-79212576 CCTACTCTACTTCCTTCACCATT No data
Right 909754863 1:79212594-79212616 ATAATTCATCACATACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909754860 Original CRISPR AATGGTGAAGGAAGTAGAGT AGG (reversed) Intergenic
No off target data available for this crispr