ID: 909764172

View in Genome Browser
Species Human (GRCh38)
Location 1:79334116-79334138
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909764168_909764172 12 Left 909764168 1:79334081-79334103 CCTAGCAATGTAAAGAGCGTATT No data
Right 909764172 1:79334116-79334138 GCATGAGCTCCCGGGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type