ID: 909773187

View in Genome Browser
Species Human (GRCh38)
Location 1:79451762-79451784
Sequence GTGTGGGATAATGCAAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909773187_909773193 28 Left 909773187 1:79451762-79451784 CCTAACTTTGCATTATCCCACAC No data
Right 909773193 1:79451813-79451835 CAATTTTATTAAGATCTTCAGGG No data
909773187_909773192 27 Left 909773187 1:79451762-79451784 CCTAACTTTGCATTATCCCACAC No data
Right 909773192 1:79451812-79451834 TCAATTTTATTAAGATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909773187 Original CRISPR GTGTGGGATAATGCAAAGTT AGG (reversed) Intergenic
No off target data available for this crispr