ID: 909773193

View in Genome Browser
Species Human (GRCh38)
Location 1:79451813-79451835
Sequence CAATTTTATTAAGATCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909773187_909773193 28 Left 909773187 1:79451762-79451784 CCTAACTTTGCATTATCCCACAC No data
Right 909773193 1:79451813-79451835 CAATTTTATTAAGATCTTCAGGG No data
909773190_909773193 11 Left 909773190 1:79451779-79451801 CCACACTCTCACAAGGATCATTA No data
Right 909773193 1:79451813-79451835 CAATTTTATTAAGATCTTCAGGG No data
909773189_909773193 12 Left 909773189 1:79451778-79451800 CCCACACTCTCACAAGGATCATT No data
Right 909773193 1:79451813-79451835 CAATTTTATTAAGATCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909773193 Original CRISPR CAATTTTATTAAGATCTTCA GGG Intergenic
No off target data available for this crispr