ID: 909784417

View in Genome Browser
Species Human (GRCh38)
Location 1:79593228-79593250
Sequence TTGGTTGCACAGCTGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909784417_909784421 11 Left 909784417 1:79593228-79593250 CCCTTCTCCAGCTGTGCAACCAA No data
Right 909784421 1:79593262-79593284 ATACAGTGCCACATGTCCCCTGG No data
909784417_909784422 14 Left 909784417 1:79593228-79593250 CCCTTCTCCAGCTGTGCAACCAA No data
Right 909784422 1:79593265-79593287 CAGTGCCACATGTCCCCTGGAGG No data
909784417_909784423 15 Left 909784417 1:79593228-79593250 CCCTTCTCCAGCTGTGCAACCAA No data
Right 909784423 1:79593266-79593288 AGTGCCACATGTCCCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909784417 Original CRISPR TTGGTTGCACAGCTGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr