ID: 909787098

View in Genome Browser
Species Human (GRCh38)
Location 1:79627620-79627642
Sequence CTGTGTGAATAGAACTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909787098_909787100 28 Left 909787098 1:79627620-79627642 CCATCCTAGTTCTATTCACACAG No data
Right 909787100 1:79627671-79627693 TTGAATGCTGTGTGTATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909787098 Original CRISPR CTGTGTGAATAGAACTAGGA TGG (reversed) Intergenic
No off target data available for this crispr