ID: 909793564

View in Genome Browser
Species Human (GRCh38)
Location 1:79703868-79703890
Sequence GAAGAATCCTTGAACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909793564_909793566 2 Left 909793564 1:79703868-79703890 CCTTCCAGGTTCAAGGATTCTTC No data
Right 909793566 1:79703893-79703915 CATCAGCCTTGCAATTAGCTAGG No data
909793564_909793568 10 Left 909793564 1:79703868-79703890 CCTTCCAGGTTCAAGGATTCTTC No data
Right 909793568 1:79703901-79703923 TTGCAATTAGCTAGGAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909793564 Original CRISPR GAAGAATCCTTGAACCTGGA AGG (reversed) Intergenic
No off target data available for this crispr