ID: 909796745

View in Genome Browser
Species Human (GRCh38)
Location 1:79749003-79749025
Sequence CTGAAACAAAATATTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909796745_909796747 13 Left 909796745 1:79749003-79749025 CCTTAAAAAATATTTTGTTTCAG No data
Right 909796747 1:79749039-79749061 GCACTCTAAAAAATAACCCATGG No data
909796745_909796748 22 Left 909796745 1:79749003-79749025 CCTTAAAAAATATTTTGTTTCAG No data
Right 909796748 1:79749048-79749070 AAAATAACCCATGGTTACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909796745 Original CRISPR CTGAAACAAAATATTTTTTA AGG (reversed) Intergenic
No off target data available for this crispr