ID: 909796747

View in Genome Browser
Species Human (GRCh38)
Location 1:79749039-79749061
Sequence GCACTCTAAAAAATAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909796745_909796747 13 Left 909796745 1:79749003-79749025 CCTTAAAAAATATTTTGTTTCAG No data
Right 909796747 1:79749039-79749061 GCACTCTAAAAAATAACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909796747 Original CRISPR GCACTCTAAAAAATAACCCA TGG Intergenic
No off target data available for this crispr