ID: 909800176

View in Genome Browser
Species Human (GRCh38)
Location 1:79796851-79796873
Sequence GAGGCTAGGTCTTTAGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909800171_909800176 -2 Left 909800171 1:79796830-79796852 CCTGGTGTTGAGGTGGGCCTGGA No data
Right 909800176 1:79796851-79796873 GAGGCTAGGTCTTTAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909800176 Original CRISPR GAGGCTAGGTCTTTAGGAAA TGG Intergenic
No off target data available for this crispr