ID: 909801908 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:79820532-79820554 |
Sequence | AAAACATATCAAGAGTCCTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
909801908_909801910 | 24 | Left | 909801908 | 1:79820532-79820554 | CCACAGGACTCTTGATATGTTTT | No data | ||
Right | 909801910 | 1:79820579-79820601 | CTTATGTGATATTTAGAAGATGG | No data | ||||
909801908_909801911 | 27 | Left | 909801908 | 1:79820532-79820554 | CCACAGGACTCTTGATATGTTTT | No data | ||
Right | 909801911 | 1:79820582-79820604 | ATGTGATATTTAGAAGATGGAGG | No data | ||||
909801908_909801913 | 29 | Left | 909801908 | 1:79820532-79820554 | CCACAGGACTCTTGATATGTTTT | No data | ||
Right | 909801913 | 1:79820584-79820606 | GTGATATTTAGAAGATGGAGGGG | No data | ||||
909801908_909801912 | 28 | Left | 909801908 | 1:79820532-79820554 | CCACAGGACTCTTGATATGTTTT | No data | ||
Right | 909801912 | 1:79820583-79820605 | TGTGATATTTAGAAGATGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
909801908 | Original CRISPR | AAAACATATCAAGAGTCCTG TGG (reversed) | Intergenic | ||
No off target data available for this crispr |