ID: 909801908

View in Genome Browser
Species Human (GRCh38)
Location 1:79820532-79820554
Sequence AAAACATATCAAGAGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909801908_909801910 24 Left 909801908 1:79820532-79820554 CCACAGGACTCTTGATATGTTTT No data
Right 909801910 1:79820579-79820601 CTTATGTGATATTTAGAAGATGG No data
909801908_909801911 27 Left 909801908 1:79820532-79820554 CCACAGGACTCTTGATATGTTTT No data
Right 909801911 1:79820582-79820604 ATGTGATATTTAGAAGATGGAGG No data
909801908_909801913 29 Left 909801908 1:79820532-79820554 CCACAGGACTCTTGATATGTTTT No data
Right 909801913 1:79820584-79820606 GTGATATTTAGAAGATGGAGGGG No data
909801908_909801912 28 Left 909801908 1:79820532-79820554 CCACAGGACTCTTGATATGTTTT No data
Right 909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909801908 Original CRISPR AAAACATATCAAGAGTCCTG TGG (reversed) Intergenic
No off target data available for this crispr