ID: 909801912

View in Genome Browser
Species Human (GRCh38)
Location 1:79820583-79820605
Sequence TGTGATATTTAGAAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909801908_909801912 28 Left 909801908 1:79820532-79820554 CCACAGGACTCTTGATATGTTTT No data
Right 909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909801912 Original CRISPR TGTGATATTTAGAAGATGGA GGG Intergenic
No off target data available for this crispr