ID: 909812197

View in Genome Browser
Species Human (GRCh38)
Location 1:79944097-79944119
Sequence GCGCCGTTTTTTAAGCTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909812192_909812197 11 Left 909812192 1:79944063-79944085 CCTCCGAGCCAGGTGCGGGATAT 0: 494
1: 1487
2: 1828
3: 1188
4: 779
Right 909812197 1:79944097-79944119 GCGCCGTTTTTTAAGCTGGTCGG No data
909812187_909812197 26 Left 909812187 1:79944048-79944070 CCGTGGGCATAGGACCCTCCGAG 0: 245
1: 1381
2: 1654
3: 1012
4: 697
Right 909812197 1:79944097-79944119 GCGCCGTTTTTTAAGCTGGTCGG No data
909812191_909812197 12 Left 909812191 1:79944062-79944084 CCCTCCGAGCCAGGTGCGGGATA 0: 496
1: 1490
2: 1803
3: 1148
4: 796
Right 909812197 1:79944097-79944119 GCGCCGTTTTTTAAGCTGGTCGG No data
909812194_909812197 3 Left 909812194 1:79944071-79944093 CCAGGTGCGGGATATAATCTCGT 0: 307
1: 1004
2: 2073
3: 1436
4: 947
Right 909812197 1:79944097-79944119 GCGCCGTTTTTTAAGCTGGTCGG No data
909812193_909812197 8 Left 909812193 1:79944066-79944088 CCGAGCCAGGTGCGGGATATAAT 0: 636
1: 1265
2: 1149
3: 581
4: 360
Right 909812197 1:79944097-79944119 GCGCCGTTTTTTAAGCTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909812197 Original CRISPR GCGCCGTTTTTTAAGCTGGT CGG Intergenic
No off target data available for this crispr