ID: 909814531

View in Genome Browser
Species Human (GRCh38)
Location 1:79975343-79975365
Sequence CACAGTAGGAGGGATGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909814524_909814531 -3 Left 909814524 1:79975323-79975345 CCACTTGCTCTCTAGCCACGCAC No data
Right 909814531 1:79975343-79975365 CACAGTAGGAGGGATGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909814531 Original CRISPR CACAGTAGGAGGGATGGGAG AGG Intergenic
No off target data available for this crispr