ID: 909817929

View in Genome Browser
Species Human (GRCh38)
Location 1:80020055-80020077
Sequence CTGGGTCATCATATGGCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909817929_909817934 -4 Left 909817929 1:80020055-80020077 CCTTGCGCCATATGATGACCCAG No data
Right 909817934 1:80020074-80020096 CCAGTGTTCCTTCCCTCTGGAGG No data
909817929_909817931 -7 Left 909817929 1:80020055-80020077 CCTTGCGCCATATGATGACCCAG No data
Right 909817931 1:80020071-80020093 GACCCAGTGTTCCTTCCCTCTGG No data
909817929_909817938 10 Left 909817929 1:80020055-80020077 CCTTGCGCCATATGATGACCCAG No data
Right 909817938 1:80020088-80020110 CTCTGGAGGATGTAGCAATAAGG No data
909817929_909817939 21 Left 909817929 1:80020055-80020077 CCTTGCGCCATATGATGACCCAG No data
Right 909817939 1:80020099-80020121 GTAGCAATAAGGTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909817929 Original CRISPR CTGGGTCATCATATGGCGCA AGG (reversed) Intergenic
No off target data available for this crispr