ID: 909819177

View in Genome Browser
Species Human (GRCh38)
Location 1:80038229-80038251
Sequence TGCTAGCAAAAATACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909819177_909819181 6 Left 909819177 1:80038229-80038251 CCTCCAAAGTATTTTTGCTAGCA No data
Right 909819181 1:80038258-80038280 GAAACTGGCCACTTACTTCAAGG No data
909819177_909819179 -9 Left 909819177 1:80038229-80038251 CCTCCAAAGTATTTTTGCTAGCA No data
Right 909819179 1:80038243-80038265 TTGCTAGCATTTCCTGAAACTGG No data
909819177_909819183 26 Left 909819177 1:80038229-80038251 CCTCCAAAGTATTTTTGCTAGCA No data
Right 909819183 1:80038278-80038300 AGGTGAGTTTTGCTTAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909819177 Original CRISPR TGCTAGCAAAAATACTTTGG AGG (reversed) Intergenic
No off target data available for this crispr