ID: 909823189

View in Genome Browser
Species Human (GRCh38)
Location 1:80092377-80092399
Sequence AACCAAATGAAGCTGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 7, 3: 15, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909823189 Original CRISPR AACCAAATGAAGCTGCTGAA GGG (reversed) Intergenic
900966949 1:5965519-5965541 AACGAAATGAAGTTCCTGACTGG + Intronic
902121389 1:14169124-14169146 AACCAAATGAAGCTGGCTTAAGG + Intergenic
902488296 1:16762498-16762520 AGCCACAGGAAGCTGCTGCAGGG - Intronic
903290199 1:22307183-22307205 AACCAAAGGAAGCAGAAGAAAGG + Intergenic
905386766 1:37610020-37610042 AGCCAAAGGAGGCTACTGAAGGG - Intergenic
908440102 1:64144771-64144793 AGCAAAATGAATCTGCTTAATGG + Intronic
908603473 1:65766552-65766574 ATCCAAATAAAGCAGATGAAAGG + Intergenic
908750683 1:67420054-67420076 AACCAAATGAAGGTGCTGATGGG - Exonic
909823189 1:80092377-80092399 AACCAAATGAAGCTGCTGAAGGG - Intergenic
910651786 1:89576119-89576141 AAACAAAGGGAGCAGCTGAAAGG - Intronic
912213443 1:107580184-107580206 AAGCAACTGAAGCTGCTGAATGG + Intronic
913051227 1:115118528-115118550 AAAAAAATGAAGCTCCTCAAAGG + Intergenic
916307091 1:163349040-163349062 AACTAAAAGATGCTGCTGAAAGG + Exonic
918533145 1:185545493-185545515 AAACAAATGGTGCTGATGAATGG + Intergenic
919279547 1:195470199-195470221 AACTAAATGATGCTGATGCAGGG - Intergenic
920147288 1:203872846-203872868 ACCTACATGAAGCTGCTGGAGGG - Intergenic
921782203 1:219178058-219178080 ATCCAAATATAGTTGCTGAATGG - Intronic
923497470 1:234537986-234538008 TACCAAATGAAGCCACGGAAGGG - Intergenic
923636879 1:235707123-235707145 GTCCAAATGAGGCCGCTGAAAGG - Intronic
924671892 1:246136756-246136778 AAATGAATGAAGTTGCTGAATGG + Intronic
1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG + Intronic
1063388491 10:5632393-5632415 GACCTCATGAAGCTGCTCAAGGG + Intergenic
1063856986 10:10266039-10266061 AACCAAAGGAAGCTTCTGGGGGG + Intergenic
1066198891 10:33127603-33127625 AACCAAATAAGGCAGCTGAGAGG - Intergenic
1067763044 10:49064131-49064153 AACCAAATGAAGACTTTGAAAGG - Intronic
1068059117 10:52044903-52044925 ACCCAGATGAAGCTTCTTAAAGG - Intronic
1068197603 10:53738078-53738100 AAGCAAATGAATCTGCTGCTAGG - Intergenic
1068746092 10:60532358-60532380 AACCAAATGTAGCTGCTACCAGG - Intronic
1068889912 10:62138028-62138050 AACCAAATGAAGATGCATATGGG - Intergenic
1069543669 10:69314156-69314178 ATCCAACAGAAGCTGCTAAAAGG + Intronic
1069660993 10:70123412-70123434 AACCAGATGGTGCTGCTGCAGGG - Exonic
1074431561 10:113399172-113399194 AACCAGATGATGCTAATGAATGG - Intergenic
1079358330 11:19748842-19748864 AAACAGATGATGCTGCTGAAAGG + Intronic
1080201206 11:29672613-29672635 AAGCAGGTGATGCTGCTGAATGG - Intergenic
1088045538 11:105446024-105446046 AAGCAAATAAAGTGGCTGAATGG + Intergenic
1088299839 11:108345159-108345181 ATCCAAGTGAAGATGCTGAATGG + Intronic
1089561122 11:119343712-119343734 AAGAAAATGAAGCTGGAGAATGG + Intronic
1090912862 11:131136537-131136559 AAGCAAAGGAAGCTGCTCAGTGG + Intergenic
1091414712 12:271332-271354 AACCAAAAGAAGCAGCAGGAGGG - Intergenic
1093201247 12:16188939-16188961 AACCAAATAGAGATGCTTAAAGG - Exonic
1095996448 12:48090510-48090532 ATCCCAATGAAATTGCTGAATGG + Intronic
1097050577 12:56221046-56221068 AATGAAATGAAGTTTCTGAACGG + Intronic
1097061916 12:56291554-56291576 TGCCAAAGAAAGCTGCTGAATGG + Intronic
1099013448 12:77319210-77319232 AATCAATTTAAGCAGCTGAAAGG + Intergenic
1099505630 12:83472580-83472602 AACCAAATCAAGATGTTGACAGG - Intergenic
1099934603 12:89110371-89110393 AAGCAAAGGAAGTTACTGAAAGG - Intergenic
1101151343 12:101885444-101885466 AACCACATTAAGCTTTTGAAGGG + Intronic
1101661481 12:106769480-106769502 AACCTCATAAAGGTGCTGAAAGG + Intronic
1102907211 12:116686004-116686026 AATCAAATGATGCTACTGGATGG + Intergenic
1103553451 12:121751824-121751846 AACCAACTGCTGCTGCTGAAAGG - Intronic
1106041753 13:26100280-26100302 AACCAAATGGGGATGCTAAATGG + Intergenic
1110667891 13:78139093-78139115 AAAAAAATGAAGCTGCTAATAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1115569001 14:34649497-34649519 TCCCAGATGAAGCTGGTGAAGGG - Intergenic
1115860592 14:37681878-37681900 AAGCCAATGGAGCAGCTGAATGG + Intronic
1115880857 14:37916568-37916590 AGCCAAATGATGCTTCTTAATGG - Intronic
1116051195 14:39805228-39805250 CACCAAATATAGCTGCTGATTGG + Intergenic
1116601061 14:46923367-46923389 AAATAAATGAAGGTGCAGAATGG + Intronic
1117345505 14:54827840-54827862 CATCAAAAGAAGCTTCTGAAGGG - Intergenic
1122527934 14:102401844-102401866 ATCCAAATGTTGCTGGTGAAAGG + Intronic
1123500050 15:20873219-20873241 GACAAAATGAATTTGCTGAAAGG - Intergenic
1123557298 15:21446917-21446939 GACAAAATGAATTTGCTGAAAGG - Intergenic
1123593523 15:21884184-21884206 GACAAAATGAATTTGCTGAAAGG - Intergenic
1123924268 15:25092605-25092627 AACAAAAGCAATCTGCTGAAAGG - Intergenic
1125276409 15:37996686-37996708 AACCAACTGAAGCTCTTTAATGG + Intergenic
1126407994 15:48342429-48342451 AAGCAAAATAAGTTGCTGAAGGG - Exonic
1126533636 15:49736500-49736522 AGCCAAATGAAGCTTCAAAAGGG + Intergenic
1127588940 15:60403502-60403524 AGTGGAATGAAGCTGCTGAAAGG + Intergenic
1127894822 15:63287978-63288000 ATCCAAATGATGCAGCTAAAAGG + Intronic
1129513228 15:76140079-76140101 ATCCAAATGAAGCGCCTGCAAGG + Intronic
1129951739 15:79597893-79597915 ACCCAAATGAAGGTTCTGTATGG - Intergenic
1130845920 15:87745442-87745464 AAAAAAATGAATCTACTGAAAGG + Intergenic
1131297128 15:91158984-91159006 AATGAAATGAGGCTGCTTAAAGG + Intronic
1131345423 15:91643373-91643395 AACCAAAGGAAGCATCTGTAAGG - Intergenic
1132202760 15:99966226-99966248 GGCCAGTTGAAGCTGCTGAAGGG - Intergenic
1132257636 15:100391062-100391084 AATCAAATAAAGATGTTGAATGG + Intergenic
1134230798 16:12427948-12427970 TGGCAAATGAAGCTGCTGCAGGG - Intronic
1135669185 16:24360601-24360623 ATCCAAATGGAGCTGCTCAGTGG - Intronic
1137819964 16:51434897-51434919 TACCAAATGAGGCTTCTCAACGG - Intergenic
1140743020 16:77958269-77958291 AACCAGAGGAAGCTGTTGAGAGG - Intronic
1141511571 16:84515426-84515448 AACCAGATGAAGCTGCCGTTTGG + Intronic
1143300356 17:5905222-5905244 ACCTAAAGGAAGCTGGTGAAGGG + Intronic
1144487046 17:15675335-15675357 AACCAAATGAAGAGTCTGAGTGG + Intronic
1146021482 17:29282661-29282683 TTCCAAATTAAGTTGCTGAAGGG + Intronic
1146632216 17:34478976-34478998 GAGCAAAAGAAGCAGCTGAAAGG + Intergenic
1148178504 17:45586765-45586787 ACCCAGATGAGGCCGCTGAAGGG - Intergenic
1148270653 17:46259690-46259712 ACCCAGATGAGGCCGCTGAAGGG + Intergenic
1148916972 17:50989799-50989821 AAGCAACTGAAGCTACAGAAGGG - Exonic
1149586917 17:57795956-57795978 AAAAAAATAAAGCTTCTGAAAGG + Intergenic
1150063031 17:62085195-62085217 AATCAAATGAAAATGCTGTAGGG + Intergenic
1151489514 17:74424506-74424528 AACCAAAGGAAAATGCCGAAAGG + Intergenic
1153666289 18:7370059-7370081 AACAAAAGGACGATGCTGAAAGG + Intergenic
1153938808 18:9958090-9958112 TAGCAATTGATGCTGCTGAAAGG - Intronic
1154274309 18:12946917-12946939 AAAAAAATGAGGCTGCAGAAGGG - Intergenic
1154458653 18:14556181-14556203 GACAAAATGAATTTGCTGAAAGG - Intergenic
1155390612 18:25332084-25332106 AGCCATTTGGAGCTGCTGAAGGG - Intronic
1155923178 18:31626183-31626205 ACCCCAAAAAAGCTGCTGAAGGG - Intronic
1158958455 18:62565648-62565670 AAATCAATGAAGCTGCAGAAGGG - Intronic
1162091167 19:8280901-8280923 AAAAAAAAGAAGCTGCTGAGAGG - Intronic
1162479193 19:10918730-10918752 CACCCAAGGAAGCTGCTGAAAGG + Intronic
1162869515 19:13574953-13574975 AACAAACTGAAGCTGGTGAGCGG - Intronic
1164511000 19:28897184-28897206 GACAAAGTGAAGCTTCTGAAGGG - Intergenic
1164637034 19:29799171-29799193 AAGCAAAAGAAGATGCTGAGAGG + Intergenic
1166164530 19:40977966-40977988 AACCAAATGCAGCTGTGGGATGG - Intergenic
1202702901 1_KI270713v1_random:1742-1764 AGCCACAGGAAGCTGCTGCAGGG + Intergenic
925707902 2:6706346-6706368 AACCAAAGCAAGCAGTTGAAAGG + Intergenic
925933731 2:8733035-8733057 AACCAAAGGATGGTGCTCAAAGG + Intronic
926325607 2:11783121-11783143 AACCACACGAAGCTGCTGGGTGG - Intronic
927635560 2:24813530-24813552 AACGGAAAGAAGCTGCTAAAGGG - Intronic
928482743 2:31698864-31698886 AATCAAGTGGAGCTGCTGACTGG - Intergenic
928652798 2:33420228-33420250 GAGTAAATGAAGCTGCTGAAGGG - Intergenic
928759395 2:34564238-34564260 AACTAATTGAAGCTGATTAACGG - Intergenic
929359433 2:41067547-41067569 AACCAAATAAAAGTGTTGAAAGG + Intergenic
929553838 2:42911588-42911610 TACCATAGGAAGCTTCTGAAGGG - Intergenic
930261445 2:49151533-49151555 AATGAAATGAAACTGCTGCAAGG + Intronic
931805912 2:65803910-65803932 AACCAAATCAAGCTGCTCTTTGG + Intergenic
932720503 2:74135403-74135425 AAACAACTGAAGCTTTTGAAGGG - Exonic
934860066 2:97757322-97757344 GACCAAATGGAGCTGCTGAATGG + Exonic
935830195 2:106994190-106994212 AACTACTTGTAGCTGCTGAAGGG - Intergenic
936252239 2:110875809-110875831 ACCTAAGTGAAGCTGTTGAAAGG + Intronic
937227889 2:120380161-120380183 CACATAAAGAAGCTGCTGAAAGG - Intergenic
938825326 2:134999101-134999123 TTCCAAATGGTGCTGCTGAAAGG + Intronic
939353886 2:141076192-141076214 GGCCAAATGAAGCTGGTGAAGGG + Intronic
939830886 2:147069341-147069363 AACTAAATGTAGCTGGTGTATGG + Intergenic
941937738 2:170999191-170999213 AAACAAATAATGCTGCTCAATGG + Intronic
942139928 2:172967557-172967579 AACAAAAGGGAGCAGCTGAAGGG + Intronic
942579024 2:177396453-177396475 AGAAAAATGAAGCAGCTGAAGGG + Intronic
944042353 2:195369869-195369891 ATGCAAATGATGCTACTGAAAGG + Intergenic
944500015 2:200349802-200349824 AACAAACTGAATTTGCTGAAAGG - Intronic
944896493 2:204170772-204170794 GAGCAAATGAAGCTGCTGTTGGG - Intergenic
1169893304 20:10476013-10476035 AACCAAGAGAAGCTTCTCAAGGG - Intronic
1170328545 20:15182960-15182982 AACCAAGTAAAGCTTCTGACTGG - Intronic
1170431417 20:16280147-16280169 ACCCAAAAGAAGCTGCCTAAAGG - Intronic
1171266138 20:23773511-23773533 AACCATAGGAAGCAGCTGCAGGG - Intergenic
1171365339 20:24618581-24618603 AAGCTAATGAAGCTGCTGTTGGG - Intronic
1172458274 20:35094691-35094713 CACCAAATGGATCTGCTGATAGG + Intergenic
1172622574 20:36329361-36329383 AAGCAAATGAAACTTCAGAAAGG - Intronic
1173874113 20:46359001-46359023 AAGCACTGGAAGCTGCTGAAGGG - Intronic
1174119933 20:48257109-48257131 AACCAAATGCAACAGCTGGAAGG - Intergenic
1175547161 20:59785814-59785836 AACAAAATGAAGCAGCTTTAAGG - Intronic
1179501977 21:41815788-41815810 CACCACATGAAGCTGCACAAGGG - Exonic
1179604638 21:42506337-42506359 AATCAAAATAAGCTGATGAAAGG + Intronic
950685784 3:14617851-14617873 ACACACATGAAGCTGATGAAAGG + Intergenic
953252554 3:41260090-41260112 AACAAAATGAAGGGGCTGGATGG - Intronic
954781403 3:53064544-53064566 AACCAAATGAAGGTGCTGATGGG - Intronic
955195908 3:56804566-56804588 ATGTAAATGAAGCTCCTGAATGG + Intronic
955330515 3:58043464-58043486 AACCACTTGAAACTGCTTAAAGG + Intronic
955565734 3:60243177-60243199 AGCAAAATGAAGCTGCTTAGAGG - Intronic
955704681 3:61715695-61715717 AAAGAAATGAAGCTGCTGGGAGG + Intronic
956418018 3:69053284-69053306 AACCAAATATAGCTGCAGACTGG - Intergenic
956666443 3:71646299-71646321 ATCCAAGTGAAGATGTTGAAAGG + Intergenic
956692622 3:71891840-71891862 AACCAAGTGAATCTGCTCCAGGG + Intergenic
956897699 3:73680335-73680357 ACCAAAATGAAGCTGCAGATAGG + Intergenic
957655745 3:83072328-83072350 AACCACATGAAGTGGTTGAATGG + Intergenic
957859263 3:85923251-85923273 AACCATATGATTTTGCTGAAAGG - Intronic
958684346 3:97373835-97373857 AACCAAATGAAATTTTTGAAGGG - Intronic
959215148 3:103442521-103442543 AACAACAAGAAGCTGCTGTAAGG - Intergenic
959293054 3:104499361-104499383 AACTAAATCAGGCAGCTGAATGG + Intergenic
959787276 3:110315454-110315476 AAACAAATCAAATTGCTGAATGG - Intergenic
960375559 3:116896882-116896904 AACAAAATTAATCTGATGAATGG - Intronic
960499280 3:118417200-118417222 AAAGCAATGAAGCTACTGAAAGG + Intergenic
961223673 3:125219833-125219855 AACAAAATGTAGATGCAGAAAGG + Intergenic
962416186 3:135184110-135184132 ACCCAAATGAATGTGATGAATGG + Intronic
962731413 3:138286871-138286893 AGCCACATGGAGATGCTGAAAGG - Intronic
962937101 3:140091128-140091150 AACCTCATGAAGCTGCTGTAAGG + Intronic
964017300 3:151963336-151963358 ACCCAAAGGAAGGTGCTGATGGG - Intergenic
964297646 3:155251701-155251723 AACAAAAAGAAGGTTCTGAAAGG + Intergenic
965815174 3:172628878-172628900 AACAAAATGAAACAACTGAAAGG - Intergenic
966966117 3:184996038-184996060 TACTGAATGAAGCTGCAGAATGG + Intronic
968985799 4:3873700-3873722 AACCAAATGCATCTGCTGCGAGG - Intergenic
971100084 4:23456874-23456896 GTCCAAATGAAGCTATTGAAGGG - Intergenic
971370354 4:26014197-26014219 AACATCATGAAGCAGCTGAAAGG + Intergenic
973687027 4:53381054-53381076 CCCCAAATGAAGTTGCAGAAAGG - Intronic
974200991 4:58640296-58640318 AAAGAAATGATGTTGCTGAAGGG - Intergenic
975330327 4:73105439-73105461 GAACAAATGAGGCTTCTGAAAGG + Intronic
975607166 4:76167122-76167144 ATCCAAATTAAGCTGCAGCATGG + Intronic
975713179 4:77180642-77180664 AAACACATGAAGCTACTGAAGGG + Intronic
975812181 4:78181141-78181163 AACCAAATGAAGGTGCTGATGGG - Intronic
975972198 4:80053298-80053320 AACCAAATGTAAGTGCAGAATGG - Intronic
976502339 4:85806055-85806077 GGTCAAATGAAGCAGCTGAATGG - Intronic
976580930 4:86736052-86736074 AAACAAATGAATTTGGTGAATGG + Intronic
977420317 4:96791422-96791444 AACCAAATGAATCTTCTGATGGG + Intergenic
978710250 4:111771446-111771468 AACCAAATGAAGATGTTGTATGG - Intergenic
979469189 4:121074022-121074044 TACCAAGAGAAGCTTCTGAAGGG - Intergenic
980412329 4:132438318-132438340 AACCTAATGAAGTTGCTGTGTGG - Intronic
980550908 4:134333865-134333887 AACTACATAACGCTGCTGAATGG + Intergenic
981326558 4:143455168-143455190 GACCAAATGCAGATGCTTAAAGG + Intronic
981475796 4:145185412-145185434 CATCAAATGTAGCAGCTGAAGGG - Intergenic
981963442 4:150571170-150571192 AAAAAAAAGAAGCTGCAGAAAGG - Intronic
982124104 4:152169599-152169621 AACCCACTGATGCTGCTAAAGGG + Intergenic
983780412 4:171663436-171663458 AACCCACTGAAGCTGAAGAAGGG + Intergenic
984091263 4:175378313-175378335 AACCACAAGAAGATTCTGAACGG + Intergenic
987086847 5:14478440-14478462 GACCAAATGGAGCCACTGAAAGG + Intronic
987791345 5:22572207-22572229 GACAAAATAAAGTTGCTGAAAGG + Intronic
988870581 5:35384978-35385000 ACCCAAGTGAAGCTGCAGTATGG - Intergenic
989484095 5:41968061-41968083 AACTAAATGAAGCTGTTGTCAGG - Intergenic
989806956 5:45620831-45620853 AACCAAATGAAGGTACTTTAAGG + Intronic
990157667 5:52897465-52897487 TTTCAAATGAAGCTGCTGACTGG - Exonic
995904308 5:117105203-117105225 AACCCAATGTGGCTGCTGAAGGG + Intergenic
996062862 5:119051320-119051342 AACCACACAAAGCTACTGAAGGG + Intronic
996632668 5:125653880-125653902 TGCCAAATGAAGCTGTTGGATGG + Intergenic
998266540 5:140671435-140671457 ACCCAGATGAGGCCGCTGAAGGG + Exonic
998433985 5:142091260-142091282 AACATAATGAAGGTGCTAAATGG + Intergenic
999682296 5:154071669-154071691 ATCCAAATAGAGATGCTGAAAGG - Intronic
1000156954 5:158561655-158561677 AAGCAGCTGAAGCTGCTGAGAGG - Intergenic
1003681045 6:8257443-8257465 AGACAAATGAAGTTGCTAAACGG + Intergenic
1003787370 6:9501604-9501626 AATCAAATGAAGCTGATTCAGGG - Intergenic
1006924319 6:37646121-37646143 AACCACATGAGGATGGTGAAAGG + Intronic
1008369050 6:50713015-50713037 AACCTAATGCTACTGCTGAACGG + Intergenic
1010329862 6:74610546-74610568 CACCAAGTCAATCTGCTGAAAGG + Intergenic
1011682941 6:89800486-89800508 AAACAAATGGAGGTGCTGAGAGG + Intronic
1011792393 6:90912574-90912596 AACCAAATGAAAACGCTGATTGG - Intergenic
1012646500 6:101690194-101690216 AATTAAATTAAGCTACTGAATGG - Intronic
1012673355 6:102085239-102085261 AACTAAATGAAACTGCTCATTGG + Intergenic
1014187043 6:118446350-118446372 AATCAAAAGAAGCTGGTTAATGG - Intergenic
1016037707 6:139400362-139400384 GACCAAATGAACCCGCAGAAAGG - Intergenic
1016172043 6:141029954-141029976 AACCTAAAGATCCTGCTGAATGG - Intergenic
1017183101 6:151573193-151573215 AAGCAAAAGAAGCTCTTGAAAGG + Exonic
1017393767 6:153972501-153972523 ATCAAAATGGAGCTGCTGCAGGG - Intergenic
1017814945 6:158009919-158009941 AACAAAATGAAGCTGCTGGAAGG - Intronic
1018686015 6:166305620-166305642 ATCAAAATGAAGCAGCTGACAGG + Exonic
1019831544 7:3335903-3335925 AAGCATAGGAAGATGCTGAAAGG + Intronic
1020456751 7:8382228-8382250 AACTAAATTAAGCCTCTGAAAGG - Intergenic
1020790576 7:12623326-12623348 TACCAAATGAAACAGCTGGAGGG + Intronic
1021196984 7:17684998-17685020 AAGCAAATACTGCTGCTGAAAGG + Intergenic
1022121629 7:27314122-27314144 AAAAAAAGGAAGGTGCTGAATGG - Intergenic
1024595747 7:50935575-50935597 AACCAAATGGAACAGCTAAAAGG - Intergenic
1025174702 7:56792798-56792820 AAACAAAATAAGCTGGTGAAGGG - Intergenic
1025555687 7:62305245-62305267 ACTCAAATGGAGCTACTGAATGG + Intergenic
1027886652 7:83916271-83916293 AAAGAAATGAAGCTTCTTAATGG + Intergenic
1030003454 7:105091427-105091449 AACCAAATAAAAATGCTCAATGG - Intronic
1030058234 7:105601881-105601903 AACCAAATGCTGCTGCAAAATGG - Intergenic
1030418868 7:109281468-109281490 AACAAAATGATTCTGATGAATGG - Intergenic
1030734742 7:113034180-113034202 AAGCAAATGATGATGCTCAAAGG + Intergenic
1035989186 8:4469363-4469385 AACCAAATCAAGGTGCAAAACGG + Intronic
1039360991 8:36876688-36876710 AACCAAATGTAGTGGCTGCAAGG - Intronic
1039883875 8:41644659-41644681 AACCCAAGGAAGTGGCTGAAAGG + Intergenic
1041328520 8:56696878-56696900 AACCAAATCCAGTTTCTGAACGG - Intergenic
1043816334 8:84806676-84806698 ACCCAAATGATTCTGCTGAATGG + Intronic
1046083299 8:109399317-109399339 AACCAAATTCAGCTGAAGAAGGG + Intronic
1046251463 8:111636824-111636846 AGAAAAAAGAAGCTGCTGAAAGG - Intergenic
1046818993 8:118616155-118616177 CACACAATGAAGCTGCTGCAGGG + Intronic
1046848108 8:118941550-118941572 AACTAAAGGAAACTTCTGAAGGG - Intronic
1047347480 8:124042185-124042207 AATCAAATGAAGATGCTGTATGG - Intronic
1048322585 8:133411887-133411909 AACAAAATGAAGATGGTGATGGG - Intergenic
1048694466 8:137009846-137009868 GAGAAAATGAAGCTGCAGAAAGG - Intergenic
1048813801 8:138312368-138312390 AAGCAAATGAAGATGCTTCAAGG + Intronic
1050706857 9:8409961-8409983 AACCAAATGAGCCTACTGAAGGG - Intronic
1051117541 9:13713772-13713794 ACTCAAATGAAGGTGCAGAATGG - Intergenic
1052474536 9:28941999-28942021 AACAAAATGAAGCTTCTATAGGG - Intergenic
1055595299 9:77859662-77859684 AAACAAATGAACATCCTGAATGG - Intronic
1055904436 9:81276353-81276375 AAGCAATTCAAGGTGCTGAAAGG + Intergenic
1060977442 9:127773241-127773263 AACCAAATTAAGCTGACAAATGG + Intronic
1203531862 Un_GL000213v1:152298-152320 GACAAAATGAATTTGCTGAAAGG - Intergenic
1186489611 X:9961253-9961275 AAGCAAATGAAGCAACTAAAGGG + Intergenic
1187144912 X:16628664-16628686 AAACAAATGAAAGTGATGAAAGG - Intronic
1188228572 X:27632387-27632409 AATAAAATGGAGCTGCTGGAGGG - Intronic
1189425874 X:40899401-40899423 AACATAAGGAAGCTTCTGAAAGG + Intergenic
1189839504 X:45058931-45058953 AAACAAATTAATCGGCTGAAAGG - Intronic
1192160724 X:68784771-68784793 AACCAAATGAAGGTGCTGATGGG + Intergenic
1192623871 X:72707886-72707908 AAAAAAATGAAGATGTTGAATGG + Intronic
1194538946 X:95146325-95146347 ACCCAATTCCAGCTGCTGAAAGG - Intergenic
1194586025 X:95735273-95735295 AATAAACTGAAGCTCCTGAATGG - Intergenic
1194897856 X:99468360-99468382 AACCGAATGAAGCCTCAGAATGG + Intergenic
1196195983 X:112839293-112839315 TACTAAATGAGGGTGCTGAAAGG + Intronic
1196348164 X:114692973-114692995 AACCACGTGAAACAGCTGAAAGG + Intronic
1197309769 X:124890305-124890327 AGCCAAATGTAACTGCTGAGGGG + Intronic
1200037629 X:153343686-153343708 AACCGGATGAAGATGCTGGAGGG - Intronic
1200052649 X:153443131-153443153 AACCACATCAGGCTGCTGCATGG - Intergenic