ID: 909823393

View in Genome Browser
Species Human (GRCh38)
Location 1:80094937-80094959
Sequence ATCAACAATAGGAGGAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909823393_909823396 -1 Left 909823393 1:80094937-80094959 CCAAAATTCCTCCTATTGTTGAT No data
Right 909823396 1:80094959-80094981 TTTCTAGTTCTATTCCATTGTGG No data
909823393_909823398 20 Left 909823393 1:80094937-80094959 CCAAAATTCCTCCTATTGTTGAT No data
Right 909823398 1:80094980-80095002 GGTTAAAATAATACTTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909823393 Original CRISPR ATCAACAATAGGAGGAATTT TGG (reversed) Intergenic
No off target data available for this crispr