ID: 909823649

View in Genome Browser
Species Human (GRCh38)
Location 1:80098256-80098278
Sequence GGTAAGCCTTGGAACCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909823649_909823659 26 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823659 1:80098305-80098327 CTGCCTCTCAAATTGATTCTGGG No data
909823649_909823653 -2 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823653 1:80098277-80098299 CCCAAGGACTGCAGTCCTTGTGG No data
909823649_909823655 -1 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823655 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data
909823649_909823656 3 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823656 1:80098282-80098304 GGACTGCAGTCCTTGTGGGCTGG No data
909823649_909823658 25 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823658 1:80098304-80098326 GCTGCCTCTCAAATTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909823649 Original CRISPR GGTAAGCCTTGGAACCTCAC TGG (reversed) Intergenic
No off target data available for this crispr