ID: 909823655

View in Genome Browser
Species Human (GRCh38)
Location 1:80098278-80098300
Sequence CCAAGGACTGCAGTCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909823649_909823655 -1 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823655 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data
909823642_909823655 22 Left 909823642 1:80098233-80098255 CCCCAAATCCACTATCTCCAAGA No data
Right 909823655 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data
909823647_909823655 5 Left 909823647 1:80098250-80098272 CCAAGACCAGTGAGGTTCCAAGG No data
Right 909823655 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data
909823644_909823655 20 Left 909823644 1:80098235-80098257 CCAAATCCACTATCTCCAAGACC No data
Right 909823655 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data
909823643_909823655 21 Left 909823643 1:80098234-80098256 CCCAAATCCACTATCTCCAAGAC No data
Right 909823655 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data
909823645_909823655 14 Left 909823645 1:80098241-80098263 CCACTATCTCCAAGACCAGTGAG No data
Right 909823655 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909823655 Original CRISPR CCAAGGACTGCAGTCCTTGT GGG Intergenic
No off target data available for this crispr