ID: 909823656

View in Genome Browser
Species Human (GRCh38)
Location 1:80098282-80098304
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909823651_909823656 -8 Left 909823651 1:80098267-80098289 CCAAGGCTTACCCAAGGACTGCA No data
Right 909823656 1:80098282-80098304 GGACTGCAGTCCTTGTGGGCTGG No data
909823649_909823656 3 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823656 1:80098282-80098304 GGACTGCAGTCCTTGTGGGCTGG No data
909823647_909823656 9 Left 909823647 1:80098250-80098272 CCAAGACCAGTGAGGTTCCAAGG No data
Right 909823656 1:80098282-80098304 GGACTGCAGTCCTTGTGGGCTGG No data
909823643_909823656 25 Left 909823643 1:80098234-80098256 CCCAAATCCACTATCTCCAAGAC No data
Right 909823656 1:80098282-80098304 GGACTGCAGTCCTTGTGGGCTGG No data
909823645_909823656 18 Left 909823645 1:80098241-80098263 CCACTATCTCCAAGACCAGTGAG No data
Right 909823656 1:80098282-80098304 GGACTGCAGTCCTTGTGGGCTGG No data
909823642_909823656 26 Left 909823642 1:80098233-80098255 CCCCAAATCCACTATCTCCAAGA No data
Right 909823656 1:80098282-80098304 GGACTGCAGTCCTTGTGGGCTGG No data
909823644_909823656 24 Left 909823644 1:80098235-80098257 CCAAATCCACTATCTCCAAGACC No data
Right 909823656 1:80098282-80098304 GGACTGCAGTCCTTGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr