ID: 909823658

View in Genome Browser
Species Human (GRCh38)
Location 1:80098304-80098326
Sequence GCTGCCTCTCAAATTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909823649_909823658 25 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823658 1:80098304-80098326 GCTGCCTCTCAAATTGATTCTGG No data
909823651_909823658 14 Left 909823651 1:80098267-80098289 CCAAGGCTTACCCAAGGACTGCA No data
Right 909823658 1:80098304-80098326 GCTGCCTCTCAAATTGATTCTGG No data
909823654_909823658 3 Left 909823654 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data
Right 909823658 1:80098304-80098326 GCTGCCTCTCAAATTGATTCTGG No data
909823652_909823658 4 Left 909823652 1:80098277-80098299 CCCAAGGACTGCAGTCCTTGTGG No data
Right 909823658 1:80098304-80098326 GCTGCCTCTCAAATTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909823658 Original CRISPR GCTGCCTCTCAAATTGATTC TGG Intergenic
No off target data available for this crispr