ID: 909823659

View in Genome Browser
Species Human (GRCh38)
Location 1:80098305-80098327
Sequence CTGCCTCTCAAATTGATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909823657_909823659 -10 Left 909823657 1:80098292-80098314 CCTTGTGGGCTGGCTGCCTCTCA No data
Right 909823659 1:80098305-80098327 CTGCCTCTCAAATTGATTCTGGG No data
909823654_909823659 4 Left 909823654 1:80098278-80098300 CCAAGGACTGCAGTCCTTGTGGG No data
Right 909823659 1:80098305-80098327 CTGCCTCTCAAATTGATTCTGGG No data
909823651_909823659 15 Left 909823651 1:80098267-80098289 CCAAGGCTTACCCAAGGACTGCA No data
Right 909823659 1:80098305-80098327 CTGCCTCTCAAATTGATTCTGGG No data
909823652_909823659 5 Left 909823652 1:80098277-80098299 CCCAAGGACTGCAGTCCTTGTGG No data
Right 909823659 1:80098305-80098327 CTGCCTCTCAAATTGATTCTGGG No data
909823649_909823659 26 Left 909823649 1:80098256-80098278 CCAGTGAGGTTCCAAGGCTTACC No data
Right 909823659 1:80098305-80098327 CTGCCTCTCAAATTGATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909823659 Original CRISPR CTGCCTCTCAAATTGATTCT GGG Intergenic
No off target data available for this crispr