ID: 909824417

View in Genome Browser
Species Human (GRCh38)
Location 1:80109335-80109357
Sequence CCAGATAAATAGCTAATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909824415_909824417 6 Left 909824415 1:80109306-80109328 CCTGTGGGGGTCGGGTGTGGGGA No data
Right 909824417 1:80109335-80109357 CCAGATAAATAGCTAATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909824417 Original CRISPR CCAGATAAATAGCTAATGCA TGG Intergenic
No off target data available for this crispr