ID: 909825012

View in Genome Browser
Species Human (GRCh38)
Location 1:80116807-80116829
Sequence ATGCTCTTCTGGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 17, 3: 73, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909825009_909825012 2 Left 909825009 1:80116782-80116804 CCAAGGAAAAAGGACCTAACAAA 0: 1
1: 41
2: 44
3: 46
4: 272
Right 909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG 0: 1
1: 0
2: 17
3: 73
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909825012 Original CRISPR ATGCTCTTCTGGAAGAGTGA AGG Intergenic
901693821 1:10991667-10991689 CTGCTCTTCTGCCTGAGTGAGGG - Intergenic
901835996 1:11924634-11924656 ATCCTGTTCTGGATGAGAGAGGG - Intronic
902609199 1:17587445-17587467 CTGATCTCCTGGAAGAGAGAAGG - Exonic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
904684896 1:32252689-32252711 AGGCTCTTCTCAAAGAGAGAAGG + Intronic
904747203 1:32718588-32718610 ATGCTCTTCTGGAATAAGGGTGG + Intergenic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
905901561 1:41584818-41584840 ATGCTATTCAGGGAGAGTCAGGG + Exonic
905929425 1:41776848-41776870 AAGATCTGCTGTAAGAGTGAAGG - Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910136026 1:83970989-83971011 CTGCTCTTCTGGGAGGGGGAAGG + Intronic
910767514 1:90797159-90797181 AGGCTCTGCTGGAAGAGCCAAGG - Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
912665577 1:111576623-111576645 CTGCTCCTCTGGAAGGGTGAGGG + Intronic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917680609 1:177362642-177362664 ATGCTCTAATGAAAGTGTGATGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920340016 1:205269752-205269774 ATGCTCTGCTGGAAGAGCTACGG + Exonic
920613240 1:207463298-207463320 GATCTCTTTTGGAAGAGTGATGG - Intronic
920826348 1:209427218-209427240 ATGCTATTCTGGAAGGAAGAGGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065695856 10:28379153-28379175 TTGCTCGTCTGGAAGAGGGTTGG - Intergenic
1065783330 10:29190632-29190654 ACGCTCTCCTGGAACACTGAGGG - Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066202476 10:33155217-33155239 CCTCTCTTCTGCAAGAGTGAAGG + Intergenic
1069979452 10:72242190-72242212 ATGCTGTGGGGGAAGAGTGAGGG + Intergenic
1070669040 10:78365234-78365256 AGGCTCTTCTGGGAGATGGATGG - Intergenic
1071394526 10:85208181-85208203 ATGCTCTACAGGATGAGTGGAGG + Intergenic
1072618622 10:97065853-97065875 ATGGTCTTCTGGAATAGTCTGGG - Intronic
1076375553 10:129981442-129981464 ATGCTGTTCTGGCAGAGGAAGGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080400618 11:31931926-31931948 TTGCTCTTCTGGGCCAGTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1084361125 11:68669364-68669386 ACACTCTTCTGGAACAGAGAGGG + Intergenic
1084587422 11:70070805-70070827 TGGCTTTTCTGGTAGAGTGAGGG - Intergenic
1084930422 11:72551318-72551340 AAGCTCTGCTGGAAGAGAAAGGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085769666 11:79313630-79313652 ATGCTCTTCTCCAAGTGTGTTGG + Intronic
1085774827 11:79356208-79356230 AACCTCTTCTGCAAGAGTGTGGG + Intronic
1085868191 11:80319621-80319643 ATGTTTTCCTGGAAGAGAGATGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088157558 11:106827037-106827059 ATGGTCTCTTGGAAAAGTGAAGG + Intronic
1088658110 11:112020739-112020761 TTGCTCCTCTGGCAGAGAGAAGG + Intronic
1089141536 11:116288713-116288735 ATGCTGTTCTTGACAAGTGAGGG + Intergenic
1089930895 11:122310491-122310513 ATGCACTTCTGGAATAGAAATGG + Intergenic
1089998733 11:122934503-122934525 CTGGTCTTCTGGAAGGTTGATGG - Exonic
1090258636 11:125303299-125303321 TTGCTCATCTGCAAAAGTGAGGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090597538 11:128335728-128335750 GTACTCTTCTGGGAGCGTGATGG + Intergenic
1091975274 12:4819585-4819607 ATGCTCTTTAGGTGGAGTGAAGG - Intronic
1092641262 12:10513259-10513281 ATGCTCCTCTGGGAGAATCAAGG + Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093635444 12:21461110-21461132 ATGGTCTCTTGGAAAAGTGAAGG - Exonic
1096829424 12:54302592-54302614 ATGATCTACTGGAAAAGGGATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098535459 12:71589402-71589424 ATGCTTTTCAGGTAGTGTGATGG - Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1098774712 12:74598086-74598108 ATGCTATTTTGGCAGAGTGCTGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100884946 12:99059278-99059300 ATGCTCTGCTGGACGATTTAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101830623 12:108253679-108253701 ATCCTCTTCCTGAAGAGTGGGGG + Intergenic
1102409295 12:112703347-112703369 ATGCTCAGCTGGAAGAATGGTGG - Intronic
1103725615 12:122996077-122996099 ATCCTTTTTTGGAAGGGTGAGGG + Intronic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1106750516 13:32760694-32760716 AAGCTCTCCTGGAAGAATAAAGG + Exonic
1110362720 13:74645533-74645555 ATGCTTTTTTGGAACAGTGTAGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111568667 13:90048906-90048928 ATTCTCTTCTGGACCAGTGGTGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113808277 13:113122469-113122491 TTTCTCTTCTGGAAAAATGATGG + Intergenic
1113890277 13:113731844-113731866 TTGCTCTTCTGCAACAGCGATGG - Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116688519 14:48074310-48074332 GTGCTGTTCTTGCAGAGTGATGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG + Intergenic
1120238575 14:81922857-81922879 ATGCTATTCAGCAAGAGTAAGGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1124616667 15:31247206-31247228 ATACGCTTTGGGAAGAGTGAGGG + Intergenic
1124849108 15:33318711-33318733 ATGCTCTTCTGAATGCCTGAAGG - Intronic
1126640861 15:50825368-50825390 ATGCTCTCCTTAAAGACTGAAGG - Intergenic
1126740890 15:51775069-51775091 GGGCCCTTCTGGAAGATTGAAGG + Intronic
1128187096 15:65651560-65651582 AAGGTCTAATGGAAGAGTGATGG - Intronic
1128678600 15:69629823-69629845 AAGCTCTTCTGAAAGAGCAATGG - Intergenic
1129153418 15:73703168-73703190 TTGCTGTTCTGGGAGATTGAAGG - Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1129293847 15:74588660-74588682 ATGCTCATCAGGAGGCGTGATGG - Intronic
1129553086 15:76474336-76474358 ATGCTCTAGTGGGAGAGAGATGG + Intronic
1130088741 15:80801451-80801473 ATGCTGTTCTGTGAGAGAGAAGG + Intronic
1131057584 15:89384725-89384747 ATGATCTTCTGGAGGAGGGAAGG + Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1133392539 16:5421769-5421791 AGGCTCATCTGGATGAGTAAGGG - Intergenic
1136283039 16:29225356-29225378 AGCCTCTTTTGGAAGAGTGAAGG + Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1137959911 16:52872134-52872156 ATTCTCTTCTGGAAGAGACATGG - Intergenic
1139454408 16:67061179-67061201 GTGTTCTTCTGGAAAAGTAAGGG - Intronic
1142087416 16:88191257-88191279 AGCCTCTTTTGGAAGAGTGAAGG + Intergenic
1142885911 17:2912005-2912027 ATCCTCTTCTGGAAAGGAGAAGG - Intronic
1143152723 17:4817222-4817244 CTGCCCTCCTGGAAGTGTGAAGG - Exonic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1144601092 17:16614629-16614651 TTGGTCCTCTGGAAGAGTGTGGG - Intergenic
1144792739 17:17870308-17870330 CTGCTGTTCTGGAACAGGGAAGG - Intronic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1147900855 17:43783119-43783141 ATGCTCATCTTGACGAGTGGGGG - Intronic
1152302430 17:79503088-79503110 ATCCTCATGTGGAAGAGAGAGGG + Intronic
1153052772 18:915555-915577 ATGCTCTTATGAAACAGTTACGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1156213399 18:34972431-34972453 ATTCTCTCCTTGAGGAGTGAAGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1158947126 18:62456800-62456822 ATGGTTTTCTGGGAAAGTGATGG - Intergenic
1159112043 18:64070549-64070571 GTTCTCTTCTGGAAGATTTAAGG + Intergenic
1159622716 18:70656894-70656916 TTTCTCTTCTGTAAGAGTGACGG + Intergenic
1159698929 18:71599173-71599195 ATTCTCCTCTGGAATATTGATGG + Intergenic
1159919665 18:74216105-74216127 ATGATGTTCTGGCAGAGGGAAGG - Intergenic
1160165059 18:76503863-76503885 CTGCGCCTCTGGAAGAGAGAGGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160360603 18:78273242-78273264 GTGTTCTTCAGGAAGACTGAAGG - Intergenic
1162126874 19:8504207-8504229 TTGCAGTTCTGGAGGAGTGAGGG + Intergenic
1162517246 19:11155822-11155844 AACCTCTTCTGGAAGAGGGCGGG - Intergenic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1168352828 19:55686380-55686402 CTGCTCTCCAGGAAGAGTGGAGG + Intronic
1168385264 19:55957845-55957867 AAGATCTTCTGGAAGAGTTTTGG - Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928847087 2:35689267-35689289 ATGGTCTTCTGGAAGAGAGAGGG - Intergenic
929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG + Intergenic
930914303 2:56668459-56668481 TTACTCTTTTGGAGGAGTGAGGG + Intergenic
932867561 2:75361573-75361595 AGACTCTTGTGGAAGATTGAGGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934491688 2:94765508-94765530 ATACTCTCATGGAATAGTGATGG - Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
936326410 2:111509327-111509349 ATGGTGTTCCGGAAGAGTCAAGG + Intergenic
936900888 2:117481040-117481062 CAGCTTTTCTGGAAGAGTGTAGG - Intergenic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
937508293 2:122561992-122562014 ATCCTCTTGTGTAAGAGAGATGG + Intergenic
938188892 2:129256495-129256517 AGGCTCTTCTGGCCCAGTGAGGG + Intergenic
938612401 2:132961080-132961102 ATGCTCCCCTGGAAGATTGCAGG - Intronic
938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG + Exonic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
941399642 2:165014961-165014983 ATGCTTTGCTGGGAGATTGAGGG + Intergenic
943211128 2:184967917-184967939 ATGCTCTTCTGGAATCTTAATGG + Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944432430 2:199647536-199647558 ATGCTCTTCTGCAACAGTCTTGG + Intergenic
945560970 2:211339713-211339735 ATGTTCTTCTGGAAGCCTAATGG - Intergenic
946347116 2:219119530-219119552 ATTCTCTTCTGAAATAGGGATGG - Intronic
947655089 2:231820029-231820051 AGGCTCTTCTGGAAGGCTGGGGG + Intergenic
948094649 2:235324136-235324158 GGGCTGTTCTGGAAGACTGAGGG - Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1170792346 20:19518475-19518497 GTGCTGTTCTTGAAGAGTGCAGG + Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173476823 20:43365540-43365562 AGGCTCTTCAGGAAGAAGGATGG - Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1179680585 21:43018307-43018329 AAGCTCTTCAGGCAGAGGGAAGG - Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183975497 22:41509648-41509670 ATGCTTTTGTGGAAGTGAGAGGG + Intronic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951603158 3:24399291-24399313 ATGCCCTTCAGGTAGACTGAGGG - Intronic
952551522 3:34484191-34484213 ATTCTTTCCTGGAAAAGTGAGGG + Intergenic
954232352 3:49227160-49227182 AACCTTTTCTGTAAGAGTGAAGG - Intronic
954775840 3:53017723-53017745 TTGCTTTTTTTGAAGAGTGAAGG - Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958747456 3:98154266-98154288 TTCCTTTTCTGGAAGATTGAGGG + Intergenic
958752780 3:98212283-98212305 TTCCTTTTCTGGAAGATTGAGGG + Intergenic
959089716 3:101888949-101888971 ATGGGCTTCTGGCTGAGTGAAGG + Intergenic
959579785 3:107971616-107971638 TTCCTCTTCTGGAAGGATGATGG + Intergenic
960124523 3:113983982-113984004 ATGCTTTTCTGGCAGGGTCATGG + Intronic
960554787 3:119015994-119016016 AAACTCATCTGAAAGAGTGAGGG + Intronic
960968842 3:123124660-123124682 CAGCTCTTCTGGAATAGTCAGGG + Intronic
961185582 3:124912321-124912343 ATGGGGTTCTGGAAGGGTGAGGG + Intronic
963226306 3:142866027-142866049 ATGCTCTTCAATAAGTGTGATGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965485838 3:169277529-169277551 GTGCTCAACTGGGAGAGTGATGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
971643407 4:29164665-29164687 ATGCCGTACTGGAAGTGTGAAGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973665845 4:53158473-53158495 TTGGTCAACTGGAAGAGTGATGG - Intronic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974550296 4:63363394-63363416 CTGCTCTTCTAGATGAGTTATGG + Intergenic
974829482 4:67172703-67172725 AAGCTCTACTGGTGGAGTGAAGG - Intergenic
974833108 4:67213297-67213319 ATGCTCATAAGGAAGAGAGAGGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975671048 4:76781053-76781075 ATGGTCATCTCGAAGAGTGTTGG - Exonic
976004095 4:80407512-80407534 ATGTTCTTCTGGCAGAGGCAGGG + Intronic
978016292 4:103750449-103750471 TTGCTGTTCTGGCAGAATGAGGG - Intergenic
978211486 4:106142772-106142794 ATTTTCTTCATGAAGAGTGATGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981578368 4:146228222-146228244 GTGCTGCTGTGGAAGAGTGATGG - Exonic
981759279 4:148175469-148175491 AAGCTTTTGTGGAAGAATGATGG - Intronic
982047228 4:151460845-151460867 AGGCTGTTGTGGAAGAGTGGAGG + Intronic
982084840 4:151823946-151823968 ATGTTTTTCTGCAAGAGAGAAGG - Intergenic
982476021 4:155851763-155851785 ATGCATATCTGGAAAAGTGATGG - Intronic
984130390 4:175867954-175867976 TTGCTCTTCTGGCAGGGAGAGGG - Intronic
984353022 4:178620301-178620323 ATGCTATAGTGGAAGAATGAAGG + Intergenic
984621228 4:181954947-181954969 ATGCTCTTTTGGTACAGTGCTGG - Intergenic
985470286 5:37955-37977 CTGCTATTCTGGAGGGGTGATGG - Intergenic
988558107 5:32255723-32255745 ATTCTCTTCAGGAAGAGGGGTGG + Exonic
988785661 5:34563811-34563833 AAGCTTTTCTGGAAAAGTAATGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993108852 5:83631009-83631031 ATGAGCTACTGGAGGAGTGAGGG + Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
997414489 5:133714677-133714699 ATGGTGTTCTGGGAGAGTAAAGG - Intergenic
998814652 5:146000831-146000853 CTGCTCTCCTGGCAGAGTAATGG + Intronic
1002139542 5:177130670-177130692 CAGCTCCTCTGGAAGACTGAGGG - Intergenic
1003423880 6:5983547-5983569 CTGCTCTTCTGGATGATTGAGGG + Intergenic
1004334192 6:14749395-14749417 ATGCACTTCTGTGAGACTGAAGG + Intergenic
1005162842 6:22884348-22884370 ATTTACTTATGGAAGAGTGAAGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1008255139 6:49289722-49289744 ATGCTCTCTTGAAAGAGGGAAGG - Intergenic
1008700224 6:54090242-54090264 ATTTTCTGCTGGAAGAGTCATGG - Intronic
1010905558 6:81483178-81483200 ATGCTATTCTCTACGAGTGATGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011150838 6:84271699-84271721 ATGCTCTGAGGGAAAAGTGAGGG + Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011357282 6:86484989-86485011 ATACTCATCTGGAAGAGTGAAGG - Intergenic
1012219468 6:96630877-96630899 ATGCTTTGCAGGAAGAATGAGGG - Intergenic
1012978978 6:105810305-105810327 TTCCTCTTTTGGAAGAGTAAAGG + Intergenic
1013308094 6:108868731-108868753 GTGCTCTTCTGGAAGGGTTGTGG + Intronic
1013859319 6:114615745-114615767 ATGCTATTTTTAAAGAGTGATGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014625793 6:123722720-123722742 ATGCTCTTGGGAGAGAGTGAAGG - Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1017564633 6:155670151-155670173 ATGATCTTATGGAGGAGTGCTGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019837505 7:3403731-3403753 GTGCTCTTCTGAAAGAGTGAGGG + Intronic
1020027199 7:4907520-4907542 ATGGTCTTCTTCAAGAGTGACGG - Exonic
1020564310 7:9776938-9776960 ATGCACTGCTGGAAGAGGAAGGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1020650458 7:10868797-10868819 ATGCCCATCTGTAAAAGTGAGGG - Intergenic
1022825623 7:34009657-34009679 CTGCTCTTTTGGAAGAGGGGAGG + Intronic
1026734303 7:72939794-72939816 ATCCATTTCTGGAAGAGGGAAGG + Intronic
1026784635 7:73294702-73294724 ATCCATTTCTGGAAGAGGGAAGG + Intergenic
1027109435 7:75425226-75425248 ATCCATTTCTGGAAGAGGGAAGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027800550 7:82744600-82744622 ATGATCTACTGGAAAAGTGCTGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030144456 7:106339430-106339452 CTTCTCTTATAGAAGAGTGAAGG - Intergenic
1032119343 7:129145071-129145093 ATGCTCTTCTGGGTGAGTCTCGG + Exonic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034084019 7:148307234-148307256 TTCCTCTTCTGCCAGAGTGAGGG + Intronic
1036863721 8:12376268-12376290 ATGCTCTTGTGGAAGCTAGATGG + Intergenic
1037005548 8:13775337-13775359 CTGCTTTTCTGGAATCGTGAGGG + Intergenic
1037663247 8:20944663-20944685 ATCCTCATCTGGAGGAGTCATGG + Intergenic
1037682141 8:21106383-21106405 TTGCTCTGATGGAAGGGTGAGGG - Intergenic
1038008381 8:23453766-23453788 ATGAATTTCTGGAAGTGTGATGG - Intronic
1038390181 8:27190641-27190663 ATGCTATCCTGGAATGGTGAGGG + Intergenic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040062503 8:43115895-43115917 ATGCTGTTCTGGAAGCCTGTGGG + Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1044621950 8:94199479-94199501 GTGTTTTTCTGGAAGACTGAAGG - Intronic
1045555901 8:103214154-103214176 ATGATCTTCAGGAAGAGTTTTGG + Intronic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047595834 8:126377060-126377082 ATTCTCCTCTAGAAAAGTGAGGG - Intergenic
1048394085 8:133996784-133996806 CTCCTCTACTGGAAGCGTGAAGG + Intergenic
1048747950 8:137636140-137636162 ATGCTCTTATGGAAAAATAATGG + Intergenic
1048830007 8:138466533-138466555 ATGCTTTCGTGGAAGAGTGGGGG + Intronic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1050038652 9:1464128-1464150 ATCCTTTACTGGAAGAGAGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052730863 9:32283630-32283652 ATGTTCATCTGCAAGTGTGATGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1062039411 9:134397171-134397193 AGGGTCTGCTGGAAGAGGGAAGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1189300946 X:39951829-39951851 CTGCACTTCTGGAAAAGAGATGG + Intergenic
1189949029 X:46209797-46209819 AGGCTGTTCTGCAAGAGTGTGGG - Intergenic
1191053219 X:56216471-56216493 ATGCTCTACTGGAAAAGCTAAGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1195037830 X:100986190-100986212 ATAGTCTTCAGGAAGAGTCAAGG - Intronic
1195291730 X:103436631-103436653 CTCCTCTCCTGGAAGAGTAATGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196542576 X:116926451-116926473 ATGCTCTTGTAGAAGAGCAAAGG + Intergenic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197318837 X:125003061-125003083 CTGCTCTGCTGGAAAATTGAGGG - Intergenic
1197577367 X:128232027-128232049 AAGCTCTTCTTCAAAAGTGAGGG + Intergenic
1197820161 X:130534003-130534025 ATGCTCATTTGGGTGAGTGAGGG + Intergenic
1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200756656 Y:6996302-6996324 ATGCTCTCCTGGGAGAGTCTTGG + Intronic