ID: 909826022

View in Genome Browser
Species Human (GRCh38)
Location 1:80127811-80127833
Sequence CTAAGGTAGAGTTTGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909826022_909826033 14 Left 909826022 1:80127811-80127833 CCATGGCCCAAACTCTACCTTAG No data
Right 909826033 1:80127848-80127870 GGCCAGAGCAGCTGGGACGCAGG No data
909826022_909826034 15 Left 909826022 1:80127811-80127833 CCATGGCCCAAACTCTACCTTAG No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826022_909826025 -7 Left 909826022 1:80127811-80127833 CCATGGCCCAAACTCTACCTTAG No data
Right 909826025 1:80127827-80127849 ACCTTAGCCCCATTCAGCCATGG No data
909826022_909826030 6 Left 909826022 1:80127811-80127833 CCATGGCCCAAACTCTACCTTAG No data
Right 909826030 1:80127840-80127862 TCAGCCATGGCCAGAGCAGCTGG No data
909826022_909826031 7 Left 909826022 1:80127811-80127833 CCATGGCCCAAACTCTACCTTAG No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909826022 Original CRISPR CTAAGGTAGAGTTTGGGCCA TGG (reversed) Intergenic