ID: 909826023

View in Genome Browser
Species Human (GRCh38)
Location 1:80127817-80127839
Sequence ATGGGGCTAAGGTAGAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909826023_909826030 0 Left 909826023 1:80127817-80127839 CCCAAACTCTACCTTAGCCCCAT No data
Right 909826030 1:80127840-80127862 TCAGCCATGGCCAGAGCAGCTGG No data
909826023_909826031 1 Left 909826023 1:80127817-80127839 CCCAAACTCTACCTTAGCCCCAT No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data
909826023_909826033 8 Left 909826023 1:80127817-80127839 CCCAAACTCTACCTTAGCCCCAT No data
Right 909826033 1:80127848-80127870 GGCCAGAGCAGCTGGGACGCAGG No data
909826023_909826034 9 Left 909826023 1:80127817-80127839 CCCAAACTCTACCTTAGCCCCAT No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909826023 Original CRISPR ATGGGGCTAAGGTAGAGTTT GGG (reversed) Intergenic