ID: 909826024

View in Genome Browser
Species Human (GRCh38)
Location 1:80127818-80127840
Sequence AATGGGGCTAAGGTAGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909826024_909826033 7 Left 909826024 1:80127818-80127840 CCAAACTCTACCTTAGCCCCATT No data
Right 909826033 1:80127848-80127870 GGCCAGAGCAGCTGGGACGCAGG No data
909826024_909826034 8 Left 909826024 1:80127818-80127840 CCAAACTCTACCTTAGCCCCATT No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826024_909826030 -1 Left 909826024 1:80127818-80127840 CCAAACTCTACCTTAGCCCCATT No data
Right 909826030 1:80127840-80127862 TCAGCCATGGCCAGAGCAGCTGG No data
909826024_909826031 0 Left 909826024 1:80127818-80127840 CCAAACTCTACCTTAGCCCCATT No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909826024 Original CRISPR AATGGGGCTAAGGTAGAGTT TGG (reversed) Intergenic