ID: 909826031

View in Genome Browser
Species Human (GRCh38)
Location 1:80127841-80127863
Sequence CAGCCATGGCCAGAGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909826021_909826031 16 Left 909826021 1:80127802-80127824 CCTCTGAAGCCATGGCCCAAACT No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data
909826020_909826031 17 Left 909826020 1:80127801-80127823 CCCTCTGAAGCCATGGCCCAAAC No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data
909826026_909826031 -10 Left 909826026 1:80127828-80127850 CCTTAGCCCCATTCAGCCATGGC No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data
909826023_909826031 1 Left 909826023 1:80127817-80127839 CCCAAACTCTACCTTAGCCCCAT No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data
909826022_909826031 7 Left 909826022 1:80127811-80127833 CCATGGCCCAAACTCTACCTTAG No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data
909826024_909826031 0 Left 909826024 1:80127818-80127840 CCAAACTCTACCTTAGCCCCATT No data
Right 909826031 1:80127841-80127863 CAGCCATGGCCAGAGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909826031 Original CRISPR CAGCCATGGCCAGAGCAGCT GGG Intergenic