ID: 909826034

View in Genome Browser
Species Human (GRCh38)
Location 1:80127849-80127871
Sequence GCCAGAGCAGCTGGGACGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909826023_909826034 9 Left 909826023 1:80127817-80127839 CCCAAACTCTACCTTAGCCCCAT No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826020_909826034 25 Left 909826020 1:80127801-80127823 CCCTCTGAAGCCATGGCCCAAAC No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826022_909826034 15 Left 909826022 1:80127811-80127833 CCATGGCCCAAACTCTACCTTAG No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826024_909826034 8 Left 909826024 1:80127818-80127840 CCAAACTCTACCTTAGCCCCATT No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826029_909826034 -10 Left 909826029 1:80127836-80127858 CCATTCAGCCATGGCCAGAGCAG No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826026_909826034 -2 Left 909826026 1:80127828-80127850 CCTTAGCCCCATTCAGCCATGGC No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826021_909826034 24 Left 909826021 1:80127802-80127824 CCTCTGAAGCCATGGCCCAAACT No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826027_909826034 -8 Left 909826027 1:80127834-80127856 CCCCATTCAGCCATGGCCAGAGC No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data
909826028_909826034 -9 Left 909826028 1:80127835-80127857 CCCATTCAGCCATGGCCAGAGCA No data
Right 909826034 1:80127849-80127871 GCCAGAGCAGCTGGGACGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909826034 Original CRISPR GCCAGAGCAGCTGGGACGCA GGG Intergenic