ID: 909829741

View in Genome Browser
Species Human (GRCh38)
Location 1:80173109-80173131
Sequence TTCATTTGGAAGCATGGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909829738_909829741 5 Left 909829738 1:80173081-80173103 CCAGAGAGAAAGATTTTAGTGCA No data
Right 909829741 1:80173109-80173131 TTCATTTGGAAGCATGGTGACGG No data
909829736_909829741 21 Left 909829736 1:80173065-80173087 CCCTTCAAAAACATTACCAGAGA No data
Right 909829741 1:80173109-80173131 TTCATTTGGAAGCATGGTGACGG No data
909829737_909829741 20 Left 909829737 1:80173066-80173088 CCTTCAAAAACATTACCAGAGAG No data
Right 909829741 1:80173109-80173131 TTCATTTGGAAGCATGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909829741 Original CRISPR TTCATTTGGAAGCATGGTGA CGG Intergenic
No off target data available for this crispr