ID: 909831472

View in Genome Browser
Species Human (GRCh38)
Location 1:80196680-80196702
Sequence GTGGGAAAAGGGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909831464_909831472 23 Left 909831464 1:80196634-80196656 CCTCAAAATATTTCAAAGAAAAG No data
Right 909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909831472 Original CRISPR GTGGGAAAAGGGAAGGTGGA TGG Intergenic
No off target data available for this crispr