ID: 909838760

View in Genome Browser
Species Human (GRCh38)
Location 1:80290899-80290921
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909838754_909838760 6 Left 909838754 1:80290870-80290892 CCAGTGTTTACTGGAACATTCCA No data
Right 909838760 1:80290899-80290921 TTTCATGTGCACACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr