ID: 909840243

View in Genome Browser
Species Human (GRCh38)
Location 1:80311789-80311811
Sequence TTCCCACAGCAGTTGGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909840237_909840243 21 Left 909840237 1:80311745-80311767 CCCAGATAGTCAGTAATTTAGGA No data
Right 909840243 1:80311789-80311811 TTCCCACAGCAGTTGGTCTAGGG No data
909840238_909840243 20 Left 909840238 1:80311746-80311768 CCAGATAGTCAGTAATTTAGGAC No data
Right 909840243 1:80311789-80311811 TTCCCACAGCAGTTGGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909840243 Original CRISPR TTCCCACAGCAGTTGGTCTA GGG Intergenic
No off target data available for this crispr