ID: 909844329

View in Genome Browser
Species Human (GRCh38)
Location 1:80372640-80372662
Sequence CAGGGGTAAGACTCTGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909844329_909844339 23 Left 909844329 1:80372640-80372662 CCTCCACCAGAGTCTTACCCCTG No data
Right 909844339 1:80372686-80372708 TAAATACATATTTTACATACAGG No data
909844329_909844333 -10 Left 909844329 1:80372640-80372662 CCTCCACCAGAGTCTTACCCCTG No data
Right 909844333 1:80372653-80372675 CTTACCCCTGGCCTTTCATCTGG No data
909844329_909844335 -6 Left 909844329 1:80372640-80372662 CCTCCACCAGAGTCTTACCCCTG No data
Right 909844335 1:80372657-80372679 CCCCTGGCCTTTCATCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909844329 Original CRISPR CAGGGGTAAGACTCTGGTGG AGG (reversed) Intergenic
No off target data available for this crispr