ID: 909848910

View in Genome Browser
Species Human (GRCh38)
Location 1:80434818-80434840
Sequence AGGGAGATCTCAGTGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909848910_909848922 12 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848922 1:80434853-80434875 CAGAGCCACTGCTGGGGGTCAGG No data
909848910_909848927 19 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848927 1:80434860-80434882 ACTGCTGGGGGTCAGGGGATGGG No data
909848910_909848918 4 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848918 1:80434845-80434867 AAGGTGCACAGAGCCACTGCTGG No data
909848910_909848921 7 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848921 1:80434848-80434870 GTGCACAGAGCCACTGCTGGGGG No data
909848910_909848919 5 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848919 1:80434846-80434868 AGGTGCACAGAGCCACTGCTGGG No data
909848910_909848920 6 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848920 1:80434847-80434869 GGTGCACAGAGCCACTGCTGGGG No data
909848910_909848924 14 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848924 1:80434855-80434877 GAGCCACTGCTGGGGGTCAGGGG No data
909848910_909848923 13 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848923 1:80434854-80434876 AGAGCCACTGCTGGGGGTCAGGG No data
909848910_909848926 18 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848926 1:80434859-80434881 CACTGCTGGGGGTCAGGGGATGG No data
909848910_909848928 22 Left 909848910 1:80434818-80434840 CCCCCAGTCACTGAGATCTCCCT No data
Right 909848928 1:80434863-80434885 GCTGGGGGTCAGGGGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909848910 Original CRISPR AGGGAGATCTCAGTGACTGG GGG (reversed) Intergenic
No off target data available for this crispr