ID: 909857508

View in Genome Browser
Species Human (GRCh38)
Location 1:80556768-80556790
Sequence AAGTTGTATTCTTAATTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909857508_909857513 30 Left 909857508 1:80556768-80556790 CCAAGCAATTAAGAATACAACTT No data
Right 909857513 1:80556821-80556843 GCAGTAGGCAACAAACTGTGGGG No data
909857508_909857512 29 Left 909857508 1:80556768-80556790 CCAAGCAATTAAGAATACAACTT No data
Right 909857512 1:80556820-80556842 AGCAGTAGGCAACAAACTGTGGG No data
909857508_909857511 28 Left 909857508 1:80556768-80556790 CCAAGCAATTAAGAATACAACTT No data
Right 909857511 1:80556819-80556841 CAGCAGTAGGCAACAAACTGTGG No data
909857508_909857509 15 Left 909857508 1:80556768-80556790 CCAAGCAATTAAGAATACAACTT No data
Right 909857509 1:80556806-80556828 AGTTTCCTCAAAGCAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909857508 Original CRISPR AAGTTGTATTCTTAATTGCT TGG (reversed) Intergenic
No off target data available for this crispr