ID: 909870354

View in Genome Browser
Species Human (GRCh38)
Location 1:80731078-80731100
Sequence ACATGGCTGCAGCTAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909870354_909870356 -10 Left 909870354 1:80731078-80731100 CCATCCACTAGCTGCAGCCATGT No data
Right 909870356 1:80731091-80731113 GCAGCCATGTGTATTGAGAGAGG No data
909870354_909870360 10 Left 909870354 1:80731078-80731100 CCATCCACTAGCTGCAGCCATGT No data
Right 909870360 1:80731111-80731133 AGGATCTCAGTGGATAAGGTAGG No data
909870354_909870359 6 Left 909870354 1:80731078-80731100 CCATCCACTAGCTGCAGCCATGT No data
Right 909870359 1:80731107-80731129 AGAGAGGATCTCAGTGGATAAGG No data
909870354_909870362 30 Left 909870354 1:80731078-80731100 CCATCCACTAGCTGCAGCCATGT No data
Right 909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG No data
909870354_909870358 0 Left 909870354 1:80731078-80731100 CCATCCACTAGCTGCAGCCATGT No data
Right 909870358 1:80731101-80731123 GTATTGAGAGAGGATCTCAGTGG No data
909870354_909870361 29 Left 909870354 1:80731078-80731100 CCATCCACTAGCTGCAGCCATGT No data
Right 909870361 1:80731130-80731152 TAGGAAGAGCAAAGTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909870354 Original CRISPR ACATGGCTGCAGCTAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr