ID: 909870355

View in Genome Browser
Species Human (GRCh38)
Location 1:80731082-80731104
Sequence ATACACATGGCTGCAGCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909870355_909870361 25 Left 909870355 1:80731082-80731104 CCACTAGCTGCAGCCATGTGTAT No data
Right 909870361 1:80731130-80731152 TAGGAAGAGCAAAGTGATTGTGG No data
909870355_909870360 6 Left 909870355 1:80731082-80731104 CCACTAGCTGCAGCCATGTGTAT No data
Right 909870360 1:80731111-80731133 AGGATCTCAGTGGATAAGGTAGG No data
909870355_909870362 26 Left 909870355 1:80731082-80731104 CCACTAGCTGCAGCCATGTGTAT No data
Right 909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG No data
909870355_909870358 -4 Left 909870355 1:80731082-80731104 CCACTAGCTGCAGCCATGTGTAT No data
Right 909870358 1:80731101-80731123 GTATTGAGAGAGGATCTCAGTGG No data
909870355_909870359 2 Left 909870355 1:80731082-80731104 CCACTAGCTGCAGCCATGTGTAT No data
Right 909870359 1:80731107-80731129 AGAGAGGATCTCAGTGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909870355 Original CRISPR ATACACATGGCTGCAGCTAG TGG (reversed) Intergenic
No off target data available for this crispr