ID: 909870357

View in Genome Browser
Species Human (GRCh38)
Location 1:80731095-80731117
Sequence AGATCCTCTCTCAATACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909870357_909870360 -7 Left 909870357 1:80731095-80731117 CCATGTGTATTGAGAGAGGATCT No data
Right 909870360 1:80731111-80731133 AGGATCTCAGTGGATAAGGTAGG No data
909870357_909870362 13 Left 909870357 1:80731095-80731117 CCATGTGTATTGAGAGAGGATCT No data
Right 909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG No data
909870357_909870363 25 Left 909870357 1:80731095-80731117 CCATGTGTATTGAGAGAGGATCT No data
Right 909870363 1:80731143-80731165 GTGATTGTGGGACTTTGCATTGG No data
909870357_909870361 12 Left 909870357 1:80731095-80731117 CCATGTGTATTGAGAGAGGATCT No data
Right 909870361 1:80731130-80731152 TAGGAAGAGCAAAGTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909870357 Original CRISPR AGATCCTCTCTCAATACACA TGG (reversed) Intergenic
No off target data available for this crispr