ID: 909870362

View in Genome Browser
Species Human (GRCh38)
Location 1:80731131-80731153
Sequence AGGAAGAGCAAAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909870354_909870362 30 Left 909870354 1:80731078-80731100 CCATCCACTAGCTGCAGCCATGT No data
Right 909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG No data
909870355_909870362 26 Left 909870355 1:80731082-80731104 CCACTAGCTGCAGCCATGTGTAT No data
Right 909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG No data
909870357_909870362 13 Left 909870357 1:80731095-80731117 CCATGTGTATTGAGAGAGGATCT No data
Right 909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909870362 Original CRISPR AGGAAGAGCAAAGTGATTGT GGG Intergenic
No off target data available for this crispr