ID: 909877547

View in Genome Browser
Species Human (GRCh38)
Location 1:80828158-80828180
Sequence ATGGAGGCCCAGATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909877547_909877551 -7 Left 909877547 1:80828158-80828180 CCACCCTCAATCTGGGCCTCCAT No data
Right 909877551 1:80828174-80828196 CCTCCATTTTTCTCTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909877547 Original CRISPR ATGGAGGCCCAGATTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr