ID: 909877551

View in Genome Browser
Species Human (GRCh38)
Location 1:80828174-80828196
Sequence CCTCCATTTTTCTCTTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909877546_909877551 -6 Left 909877546 1:80828157-80828179 CCCACCCTCAATCTGGGCCTCCA No data
Right 909877551 1:80828174-80828196 CCTCCATTTTTCTCTTGTGCTGG No data
909877547_909877551 -7 Left 909877547 1:80828158-80828180 CCACCCTCAATCTGGGCCTCCAT No data
Right 909877551 1:80828174-80828196 CCTCCATTTTTCTCTTGTGCTGG No data
909877548_909877551 -10 Left 909877548 1:80828161-80828183 CCCTCAATCTGGGCCTCCATTTT No data
Right 909877551 1:80828174-80828196 CCTCCATTTTTCTCTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909877551 Original CRISPR CCTCCATTTTTCTCTTGTGC TGG Intergenic
No off target data available for this crispr