ID: 909879166

View in Genome Browser
Species Human (GRCh38)
Location 1:80850773-80850795
Sequence GAGGAAAATAACTCCTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909879166_909879173 27 Left 909879166 1:80850773-80850795 CCAACACAGGAGTTATTTTCCTC No data
Right 909879173 1:80850823-80850845 CACCACACTCAGTCGCTTACTGG No data
909879166_909879170 -2 Left 909879166 1:80850773-80850795 CCAACACAGGAGTTATTTTCCTC No data
Right 909879170 1:80850794-80850816 TCCTAGAAATGGGTTTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909879166 Original CRISPR GAGGAAAATAACTCCTGTGT TGG (reversed) Intergenic
No off target data available for this crispr