ID: 909879173

View in Genome Browser
Species Human (GRCh38)
Location 1:80850823-80850845
Sequence CACCACACTCAGTCGCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909879171_909879173 5 Left 909879171 1:80850795-80850817 CCTAGAAATGGGTTTGTCTTGGT No data
Right 909879173 1:80850823-80850845 CACCACACTCAGTCGCTTACTGG No data
909879166_909879173 27 Left 909879166 1:80850773-80850795 CCAACACAGGAGTTATTTTCCTC No data
Right 909879173 1:80850823-80850845 CACCACACTCAGTCGCTTACTGG No data
909879169_909879173 8 Left 909879169 1:80850792-80850814 CCTCCTAGAAATGGGTTTGTCTT No data
Right 909879173 1:80850823-80850845 CACCACACTCAGTCGCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909879173 Original CRISPR CACCACACTCAGTCGCTTAC TGG Intergenic
No off target data available for this crispr