ID: 909881427

View in Genome Browser
Species Human (GRCh38)
Location 1:80884199-80884221
Sequence TTCTCTCCTCCTTTTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909881427_909881430 30 Left 909881427 1:80884199-80884221 CCTTCCTTAAAAGGAGGAGAGAA No data
Right 909881430 1:80884252-80884274 GTCGTACATCAAAAACAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909881427 Original CRISPR TTCTCTCCTCCTTTTAAGGA AGG (reversed) Intergenic
No off target data available for this crispr