ID: 909881430

View in Genome Browser
Species Human (GRCh38)
Location 1:80884252-80884274
Sequence GTCGTACATCAAAAACAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909881427_909881430 30 Left 909881427 1:80884199-80884221 CCTTCCTTAAAAGGAGGAGAGAA No data
Right 909881430 1:80884252-80884274 GTCGTACATCAAAAACAAATAGG No data
909881428_909881430 26 Left 909881428 1:80884203-80884225 CCTTAAAAGGAGGAGAGAATGAG No data
Right 909881430 1:80884252-80884274 GTCGTACATCAAAAACAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909881430 Original CRISPR GTCGTACATCAAAAACAAAT AGG Intergenic
No off target data available for this crispr